Question

If the sequence of coding strand in a transcription unit is written as follows :
5’– ATGCATGCATGCATGCATGCATGCATGC –3’ Write down the sequence of mRNA.

Solution

Since the Coding strand is complementary to Template strand the mRNA formed from the Template strand has the same sequence as the coding strand. The mRNA will have U in place of T as it is a RNA.
Therefore the sequence of mRNA shall be :

5’– AUGCAUGCAUGCAUGCAUGCAUGCAUGC –3’.

Some More Questions From Molecular Basis of Inheritance Chapter

What is the difference between DNAs and DNAase ?

Which was first genetic material ?

For Daily Free Study Material Join wiredfaculty

Molecular Basis Of Inheritance

If the sequence of coding strand in a transcription unit is written as follows :
5’– ATGCATGCATGCATGCATGCATGCATGC –3’ Write down the sequence of mRNA.

Some More Questions From Molecular Basis of Inheritance Chapter

What is the difference between DNAs and DNAase ?

Which was first genetic material ?

Suggest one evidence to prove that RNA was first genetic material.

Why was RNA unstable ?

What made DNA more preferrable as genetic material ?

Process of replication is completed in how much time in E.coli ?

What is average rate of polymerization ?

List three components of transcription unit.

Which RNA acts as an adapter ?

Name three kinds of polymerases.

Mock Test Series

NCERT Sample Papers

Entrance Exams Preparation

Phone Number

Email Address

Location

For Daily Free Study Material Join wiredfaculty

Molecular Basis Of Inheritance

If the sequence of coding strand in a transcription unit is written as follows : 5’– ATGCATGCATGCATGCATGCATGCATGC –3’ Write down the sequence of mRNA.

Some More Questions From Molecular Basis of Inheritance Chapter

What is the difference between DNAs and DNAase ?

Which was first genetic material ?

Suggest one evidence to prove that RNA was first genetic material.

Why was RNA unstable ?

What made DNA more preferrable as genetic material ?

Process of replication is completed in how much time in E.coli ?

What is average rate of polymerization ?

List three components of transcription unit.

Which RNA acts as an adapter ?

Name three kinds of polymerases.

Mock Test Series

NCERT Sample Papers

Entrance Exams Preparation

If the sequence of coding strand in a transcription unit is written as follows :
5’– ATGCATGCATGCATGCATGCATGCATGC –3’ Write down the sequence of mRNA.